G212296


Basic Information

Item Value
gene id G212296
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000050
NCBI id null
chromosome length 7556436
location 909813 ~ 910029 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU240821
TTATTATTAGGCTATTAATTAACAGTTAATCAAGTGTAAGAAATTATGTTCAGTTGGTTTTATTATGCACTAATTTGTTTTCTTACGCATTATATAGTAAGCTATGCGTTTTTTAAAATATAAAAAACGAAATATAATTCGTATATACTTAGGATAATAATTAACTTGACAGTTTGGGGAGACCCGATTTGTCATGACACCGTTAGGTTTAAAGGGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU240821 True 217 lncRNA 0.28 1 909813 910029

Neighbor

gene id symbol gene type direction distance location
CI01000050_00851621_00899726 MIB2 coding upstream 8649 851526 ~ 901164 (+)
CI01000050_00818849_00822703 UBIAD1 coding upstream 86674 818849 ~ 823139 (+)
CI01000050_00770066_00782851 CDK11A, CDK11B coding upstream 126841 770066 ~ 782972 (+)
CI01000050_00753574_00762446 S35E2, SLC35E2B coding upstream 147046 752374 ~ 762767 (+)
CI01000050_00718711_00742201 NA coding upstream 167612 718711 ~ 742201 (+)
CI01000050_00916485_00921744 DCAF1 coding downstream 6456 916485 ~ 921744 (+)
CI01000050_00931338_00939002 DCAF1 coding downstream 21309 931338 ~ 939002 (+)
CI01000050_00967544_00997883 BSN, BSNA coding downstream 57515 967544 ~ 997883 (+)
CI01000050_01002924_01005496 NA coding downstream 92895 1002924 ~ 1005514 (+)
CI01000050_01023375_01033682 APEH coding downstream 113346 1023375 ~ 1034169 (+)
G212294 NA non-coding upstream 81728 827818 ~ 828085 (+)
G212293 NA non-coding upstream 82685 826804 ~ 827128 (+)
G212104 NA non-coding upstream 145378 763998 ~ 764435 (+)
G212269 NA non-coding upstream 163235 745947 ~ 746578 (+)
G212261 NA non-coding upstream 245664 663684 ~ 664149 (+)
G212366 NA non-coding downstream 262105 1172134 ~ 1176043 (+)
G212376 NA non-coding downstream 285996 1196025 ~ 1201801 (+)
G212357 NA non-coding downstream 323063 1233092 ~ 1233734 (+)
G212466 NA non-coding downstream 422338 1332367 ~ 1336316 (+)
G212473 NA non-coding downstream 448574 1358603 ~ 1363929 (+)
G212184 NA other upstream 475607 433684 ~ 434206 (+)
G212006 NA other upstream 771802 82604 ~ 138011 (+)
CI01000050_00012155_00026251 NA other upstream 883401 12079 ~ 26412 (+)
CI01000050_01296683_01297763 SELENOK other downstream 386617 1296365 ~ 1298255 (+)
CI01000050_01691894_01697791 SULT1ST2, SULT1ST3 other downstream 781774 1691374 ~ 1698973 (+)
G212927 NA other downstream 1864810 2774839 ~ 2775133 (+)
CI01000050_02852118_02864754 RNF122 other downstream 1932790 2852118 ~ 2865822 (+)
CI01000050_03807697_03808793 CLCN5B, CLCN5 other downstream 2895114 3805143 ~ 3808870 (+)

Expression


Co-expression Network