RNA id: TCONS_00007523


Basic Information

Item Value
RNA id TCONS_00007523
length 153
RNA type mRNA
GC content 0.50
exon number 1
gene id XLOC_003926
representative False

Chromosome Information

Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 9564154 ~ 9985415 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ACATTCGTGAAAGCGGGAGCCCCAAACCTGTGATGGTTTTCGTTCACGGTGGATCGTACATGGAAGGAACAGGAAATATGTTCGACGGAAGCATCTTAGCCAGTTACGGCAATGTCATCGTCATAACCGTCAACTATCGGCTTGGTGTGCTCG

Function

GO:

id name namespace
GO:0048488 synaptic vesicle endocytosis biological_process
GO:0002040 sprouting angiogenesis biological_process
GO:0097104 postsynaptic membrane assembly biological_process
GO:0097105 presynaptic membrane assembly biological_process
GO:0007268 chemical synaptic transmission biological_process
GO:0050804 modulation of chemical synaptic transmission biological_process
GO:0050808 synapse organization biological_process
GO:0007155 cell adhesion biological_process
GO:0007158 neuron cell-cell adhesion biological_process
GO:0060076 excitatory synapse cellular_component
GO:0045202 synapse cellular_component
GO:0005887 integral component of plasma membrane cellular_component
GO:0009986 cell surface cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0038023 signaling receptor activity molecular_function
GO:0042043 neurexin family protein binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-090918-1 Predicted to enable neurexin family protein binding activity and signaling receptor activity. Acts upstream of or within sprouting angiogenesis. Predicted to be located in excitatory synapse and plasma membrane. Predicted to be integral component of membrane. Predicted to be active in cell surface and synapse. Predicted to be integral component of plasma membrane. Is expressed in several structures, including brain; cardiovascular system; eye; gonad; and swim bladder. Orthologous to human NLGN1 (neuroligin 1).

Ensembl:

ensembl_id ENSDART00000167465

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00008455 lncRNA downstream 285020 9521226 ~ 9523184 (-) True XLOC_003922
TCONS_00008766 lncRNA downstream 285587 9510569 ~ 9522617 (-) False XLOC_003922
TCONS_00008765 lncRNA downstream 285638 9510569 ~ 9522566 (-) False XLOC_003922
TCONS_00008767 lncRNA downstream 285655 9512829 ~ 9522549 (-) False XLOC_003922
TCONS_00008454 lncRNA downstream 294933 9510189 ~ 9513271 (-) False XLOC_003922
TCONS_00008768 lncRNA upstream 496774 10305130 ~ 10328527 (-) True XLOC_003927
TCONS_00007541 lncRNA upstream 1050668 10859024 ~ 10860106 (-) True XLOC_003933
TCONS_00007547 lncRNA upstream 1510834 11319190 ~ 11325620 (-) False XLOC_003936
TCONS_00008456 lncRNA upstream 1534924 11343280 ~ 11343574 (-) True XLOC_003939
TCONS_00008457 lncRNA upstream 1545618 11353974 ~ 11354268 (-) True XLOC_003940
TCONS_00007515 mRNA downstream 1025333 8635785 ~ 8782871 (-) True XLOC_003921
TCONS_00007512 mRNA downstream 1457259 8306007 ~ 8350945 (-) True XLOC_003919
TCONS_00007511 mRNA downstream 1487336 8303941 ~ 8320868 (-) False XLOC_003919
TCONS_00007509 mRNA downstream 1519279 8284686 ~ 8288925 (-) False XLOC_003918
TCONS_00007507 mRNA downstream 1536830 8267118 ~ 8271374 (-) False XLOC_003916
TCONS_00007524 mRNA upstream 138326 9946682 ~ 9985415 (-) True XLOC_003926
TCONS_00007525 mRNA upstream 579947 10388303 ~ 10456553 (-) False XLOC_003928
TCONS_00007526 mRNA upstream 580281 10388637 ~ 10456388 (-) False XLOC_003928
TCONS_00007527 mRNA upstream 581018 10389374 ~ 10456387 (-) False XLOC_003928
TCONS_00007529 mRNA upstream 583307 10391663 ~ 10456553 (-) False XLOC_003928
TCONS_00007494 other downstream 1682009 8111369 ~ 8126195 (-) True XLOC_003913
TCONS_00007477 other downstream 2691841 7116247 ~ 7116363 (-) True XLOC_003904
TCONS_00007463 other downstream 2860186 6944300 ~ 6948018 (-) False XLOC_003898
TCONS_00007456 other downstream 3026128 6780708 ~ 6782076 (-) True XLOC_003894
TCONS_00007441 other downstream 3601615 6197276 ~ 6206589 (-) False XLOC_003884
TCONS_00007548 other upstream 1517166 11325522 ~ 11331050 (-) False XLOC_003936
TCONS_00007549 other upstream 1522369 11330725 ~ 11331090 (-) True XLOC_003936
TCONS_00007551 other upstream 1530448 11338804 ~ 11339100 (-) True XLOC_003938
TCONS_00007552 other upstream 1559238 11367594 ~ 11367890 (-) True XLOC_003942
TCONS_00007553 other upstream 1562099 11370455 ~ 11370653 (-) True XLOC_003943

Expression Profile

//

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
grasscarp (Ctenopharyngodon idella) CI01000056_01211952_01214139.mRNA False 423 mRNA 0.44 4 CI01000056 1211906 ~ 1214139 (-)