G214632


Basic Information

Item Value
gene id G214632
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000050
NCBI id null
chromosome length 7556436
location 3904775 ~ 3905081 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU243528
TCAAATATGCAAAAAATGCTGGAAAACTGAAGAATCTGCAGGACCTGGAGGATTTTTCTGAAGAACAGAGCTCAGTTTAACTGCTCAGGACAAACAAGAGACTCATGAACAACCATCACAAAACAAAAAAACAGTCATAGATCATCCAGGTAACCACACACAGTATTAAGAATCAATGGTTCACATACTTATGAATGGGGTTATTTTAATAAATTCAGCTATTTTTTTTGTCTTGTGGATTATATGTAAACATCTTTTATGTAAAATATCTTACTCAGGACAGTACTAAATAAAAAATAACATGCAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU243528 True 307 lncRNA 0.32 1 3904775 3905081

Neighbor

gene id symbol gene type direction distance location
CI01000050_03814516_03818892 NA coding upstream 85836 3813420 ~ 3818939 (+)
CI01000050_03807697_03808793 CLCN5B, CLCN5 coding upstream 95905 3805143 ~ 3808870 (+)
CI01000050_03679119_03683710 NA coding upstream 220606 3679080 ~ 3684169 (+)
CI01000050_03641769_03645039 NA coding upstream 259666 3639187 ~ 3645109 (+)
CI01000050_03599274_03618237 SLC25A37 coding upstream 285735 3599274 ~ 3619040 (+)
CI01000050_03938328_03956122 RHOBTB2 coding downstream 33247 3931890 ~ 3957044 (+)
CI01000050_03989489_04121180 NA coding downstream 83176 3988257 ~ 4121393 (+)
CI01000050_04122649_04127014 EGR3 coding downstream 217568 4122649 ~ 4127045 (+)
CI01000050_04159232_04161131 NA coding downstream 253930 4159011 ~ 4161131 (+)
CI01000050_04190820_04204792 BIN3 coding downstream 285739 4190820 ~ 4205923 (+)
G214605 NA non-coding upstream 1047 3873155 ~ 3903728 (+)
G214601 NA non-coding upstream 35269 3869280 ~ 3869506 (+)
G214567 NA non-coding upstream 61049 3843380 ~ 3843726 (+)
G214506 NA non-coding upstream 142252 3758375 ~ 3762523 (+)
G214575 NA non-coding downstream 2028 3907109 ~ 3961365 (+)
G214571 NA non-coding downstream 7716 3912797 ~ 3917161 (+)
G214719 NA non-coding downstream 204414 4109495 ~ 4109890 (+)
G214725 NA non-coding downstream 210285 4115366 ~ 4115601 (+)
CI01000050_02852118_02864754 RNF122 other upstream 1038953 2852118 ~ 2865822 (+)
G212927 NA other upstream 1129642 2774839 ~ 2775133 (+)
CI01000050_01691894_01697791 SULT1ST2, SULT1ST3 other upstream 2207367 1691374 ~ 1698973 (+)
CI01000050_01296683_01297763 SELENOK other upstream 2605169 1296365 ~ 1298255 (+)
G214717 NA other downstream 202501 4107582 ~ 4108280 (+)
CI01000050_04591548_04592778 NA other downstream 686474 4589926 ~ 4593049 (+)
CI01000050_05407682_05409108 FKBP1B, FKBP1AA, FKBP1AB, FKBP1A, FKB1B, FKB1A other downstream 1502504 5407585 ~ 5409417 (+)
G215539 NA other downstream 1724529 5629610 ~ 5631203 (+)

Expression


Co-expression Network