RNA id: TCONS_00031658


Basic Information

Item Value
RNA id TCONS_00031658
length 420
RNA type mRNA
GC content 0.46
exon number 4
gene id XLOC_015976
representative True

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 55982300 ~ 55990329 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CATGGACGCCATGGTGAACACTGTTAAAGGATGGATGGAGAACCCGGTGAAGTTTGCACGATCCCATGGCGTGAGCGTTTCCACCACATCTGACCCTGATAGTGACATCCACATACTCATTGTGGAGGGATTTCTGCTTTATAACTACAAGCCTTTAATTGACGTCTATAACAAGTGCTTCTACGTCACCATTCCATATGAAGAGTGCAAAAGGAGAAGAAGTACGAGAACGTACACCGTTCCTGACCCACCCGGTCTGTTTGACGGCCATGTTTGGCCAATGTACTTGAAACACAGGACAGAAATGGAGAACAGCAGCTTGGATATCCAATATCTGGACGGCATGAGCTCTAAGGACGAGCTCTATAACCAACTTTATGAAGACATTCAGAACTCTCTGTTGAACATCTTATAGGTGAG

Function

GO:

id name namespace
GO:0005575 cellular_component cellular_component
GO:0016301 kinase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040912-44 Predicted to enable ribosylnicotinamide kinase activity. Predicted to be active in cytoplasm. Orthologous to human NMRK2 (nicotinamide riboside kinase 2).

Ensembl:

ensembl_id ENSDART00000183599

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00031654 lncRNA upstream 772 55982949 ~ 55984016 (+) False XLOC_015976
TCONS_00033721 lncRNA upstream 200343 55782537 ~ 55784445 (+) True XLOC_015974
TCONS_00033720 lncRNA upstream 204751 55777822 ~ 55780037 (+) True XLOC_015973
TCONS_00033325 lncRNA upstream 381223 55603128 ~ 55603565 (+) True XLOC_015971
TCONS_00033719 lncRNA upstream 715498 55268020 ~ 55269290 (+) True XLOC_015968
TCONS_00033723 lncRNA downstream 135310 56125003 ~ 56130443 (+) False XLOC_015978
TCONS_00033724 lncRNA downstream 135475 56125168 ~ 56130443 (+) False XLOC_015978
TCONS_00033725 lncRNA downstream 135478 56125171 ~ 56126826 (+) True XLOC_015978
TCONS_00033326 lncRNA downstream 182400 56172093 ~ 56172528 (+) True XLOC_015981
TCONS_00033327 lncRNA downstream 334641 56324334 ~ 56335388 (+) True XLOC_015983
TCONS_00031647 mRNA upstream 13818 55914699 ~ 55970970 (+) False XLOC_015975
TCONS_00031650 mRNA upstream 36578 55916911 ~ 55948210 (+) False XLOC_015975
TCONS_00031649 mRNA upstream 36578 55916911 ~ 55948210 (+) False XLOC_015975
TCONS_00031648 mRNA upstream 36578 55916911 ~ 55948210 (+) True XLOC_015975
TCONS_00031646 mRNA upstream 311563 55665323 ~ 55673225 (+) True XLOC_015972
TCONS_00031659 mRNA downstream 22323 56012016 ~ 56041890 (+) False XLOC_015977
TCONS_00031660 mRNA downstream 22377 56012070 ~ 56040091 (+) True XLOC_015977
TCONS_00031661 mRNA downstream 150248 56139941 ~ 56162607 (+) False XLOC_015979
TCONS_00031664 mRNA downstream 178926 56168619 ~ 56237133 (+) False XLOC_015980
TCONS_00031663 mRNA downstream 178926 56168619 ~ 56237133 (+) False XLOC_015980
TCONS_00031635 other upstream 1198048 54755172 ~ 54786740 (+) False XLOC_015963
TCONS_00031622 other upstream 2298600 53686071 ~ 53686188 (+) True XLOC_015951
TCONS_00031613 other upstream 3845092 52122720 ~ 52139696 (+) True XLOC_015939
TCONS_00031589 other upstream 5092844 50862527 ~ 50891944 (+) False XLOC_015923
TCONS_00031582 other upstream 5394340 50590332 ~ 50590448 (+) True XLOC_015919
TCONS_00031662 other downstream 150279 56139972 ~ 56162604 (+) True XLOC_015979
TCONS_00031668 other downstream 473518 56463211 ~ 56476884 (+) True XLOC_015985
TCONS_00031669 other downstream 497975 56487668 ~ 56493661 (+) True XLOC_015986
TCONS_00031670 other downstream 508201 56497894 ~ 56507389 (+) True XLOC_015987
TCONS_00031672 other downstream 848988 56838681 ~ 56838799 (+) True XLOC_015991

Expression Profile

//