RNA id: TCONS_00043217


Basic Information

Item Value
RNA id TCONS_00043217
length 499
RNA type mRNA
GC content 0.54
exon number 6
gene id XLOC_021789
representative False

Chromosome Information

Item Value
chromosome id NC_007134.7
NCBI id CM002907.2
chromosome length 46223584
location 31431956 ~ 31435922 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CGACACTATGACGTCCTCTTTACCCGCAGTCAGAGGGAAGGAATAACTCCTCGCATCCATCGCTAATCTACAATGGCCGAGGAAGGCATCGCTGCCGGAGGTGTGATGGATGTCAACACCGCTCTGCCTGAAGTGCTGAAGACCGCACTCATCCACGACGGTCTGGCCCGCGGTATCCGTGAGGCCGCCAAGGCCCTCGACAAGCGCCAGGCTCATCTTTGCGTCCTCGCTGCAAACTGTGACGAGCCCATGTACGTCAAGCTGGTGGAGGCTCTCTGTGCCGAGCATCAGATCAACCTCATCAAGGTTGATGACAATAAGAAGCTCGGGGAATGGGTTGGTCTGTGTAAGATCGACAGAGAGGGCAAACCCCGCAAGGTGGTGGGCTGCAGCTGTGTAGTCATCAAGGACTACGGCAAAGAGTCCCAGGCTAAGGACGTCATTGAAGAGTACTTCAAATCCAAGAAATAAGGCGCCAAATAAAATTGTTTGGAAAAGA

Function

GO:

id name namespace
GO:0006412 translation biological_process
GO:0022627 cytosolic small ribosomal subunit cellular_component
GO:0005840 ribosome cellular_component
GO:0003735 structural constituent of ribosome molecular_function

KEGG:

id description
ko03010 Ribosome
ko05171 Coronavirus disease - COVID-19
ko03011 Ribosome

ZFIN:

id description
ZDB-GENE-030131-8951 Predicted to be a structural constituent of ribosome. Predicted to act upstream of or within translation. Predicted to be located in ribosome. Predicted to be part of cytosolic small ribosomal subunit. Orthologous to human RPS12 (ribosomal protein S12).

Ensembl:

ensembl_id ENSDART00000138350

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00043214 lncRNA upstream 183011 31245431 ~ 31248945 (+) False XLOC_021787
TCONS_00043215 lncRNA upstream 183166 31245792 ~ 31248790 (+) True XLOC_021787
TCONS_00044850 lncRNA upstream 346005 31078564 ~ 31085951 (+) True XLOC_021785
TCONS_00043203 lncRNA upstream 659070 30764287 ~ 30772886 (+) True XLOC_021777
TCONS_00044849 lncRNA upstream 998571 30402314 ~ 30433385 (+) True XLOC_021774
TCONS_00044851 lncRNA downstream 427817 31863739 ~ 31885913 (+) True XLOC_021795
TCONS_00043238 lncRNA downstream 592703 32028625 ~ 32038219 (+) False XLOC_021802
TCONS_00043241 lncRNA downstream 598819 32034741 ~ 32038219 (+) False XLOC_021802
TCONS_00043242 lncRNA downstream 601165 32037087 ~ 32038060 (+) False XLOC_021802
TCONS_00043249 lncRNA downstream 758486 32194408 ~ 32201494 (+) True XLOC_021805
TCONS_00043216 mRNA upstream 8227 31405497 ~ 31423729 (+) True XLOC_021788
TCONS_00043213 mRNA upstream 183004 31245395 ~ 31248952 (+) False XLOC_021787
TCONS_00043212 mRNA upstream 313585 31107685 ~ 31118371 (+) True XLOC_021786
TCONS_00043211 mRNA upstream 409538 31000243 ~ 31022418 (+) True XLOC_021784
TCONS_00043210 mRNA upstream 435200 30985530 ~ 30996756 (+) True XLOC_021783
TCONS_00043221 mRNA downstream 160272 31596194 ~ 31605592 (+) False XLOC_021792
TCONS_00043222 mRNA downstream 160519 31596441 ~ 31605307 (+) True XLOC_021792
TCONS_00043224 mRNA downstream 379501 31815423 ~ 31830043 (+) False XLOC_021794
TCONS_00043225 mRNA downstream 379570 31815492 ~ 31829033 (+) True XLOC_021794
TCONS_00043226 mRNA downstream 476960 31912882 ~ 31914996 (+) False XLOC_021796
TCONS_00043209 other upstream 452457 30979385 ~ 30979499 (+) True XLOC_021782
TCONS_00043184 other upstream 1843398 29588444 ~ 29588558 (+) True XLOC_021766
TCONS_00043178 other upstream 2069111 29357790 ~ 29362845 (+) False XLOC_021762
TCONS_00043179 other upstream 2069423 29357952 ~ 29362533 (+) False XLOC_021762
TCONS_00043174 other upstream 2505916 28925923 ~ 28926040 (+) True XLOC_021760
TCONS_00043223 other downstream 231507 31667429 ~ 31667543 (+) True XLOC_021793
TCONS_00043229 other downstream 497753 31933675 ~ 31940874 (+) True XLOC_021797
TCONS_00043240 other downstream 596843 32032765 ~ 32038219 (+) False XLOC_021802
TCONS_00043247 other downstream 665289 32101211 ~ 32107481 (+) False XLOC_021804
TCONS_00043259 other downstream 971273 32407195 ~ 32409927 (+) True XLOC_021810

Expression Profile

//