RNA id: TCONS_00043242


Basic Information

Item Value
RNA id TCONS_00043242
length 479
lncRNA type retained_intron
GC content 0.46
exon number 2
gene id XLOC_021802
representative False

Chromosome Information

Item Value
chromosome id NC_007134.7
NCBI id CM002907.2
chromosome length 46223584
location 32028574 ~ 32060885 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ACTTCCTTCCAACTTTCACCACTACTGTTGTCTCAACCTGACCATTTCACATGGTCCTCTTTTGTTCACATTTGGCACTTTCTCAAGCCAATACTACTAATTCTGCAGTCCCAGAGGGCTTTCAGTTGGCAACAGAGCGGAGAGCCAAGGAGCGCTTGGAGTTTGAGAAGGAGTTGAGCGAGAGGGAAGCGCTTAGGGCTCGCATGGAGGAGGAGCGTGCCAGAGAACGAGAGCAGCAAGAAAAGGAGGAGATTGCAAGACTGCGACAGGAACAGGTGTGCAAGGCCCAGCCAATCAGGCACTACAAACCAGTAGAGCTGAAAAAGAGTGATGTATCCCTCACAGTGCCCCAGTCACCAAACTTTTCTGATCGTTTCCGCATGTAAATGCATCTTATGTTGACTTAATTGTACAGTTTTCTTGTGTTTTGACTTGTTTTATATCTTTCTATAATGTCTTTTTATGGGAATATTTAGAGG

Function

GO:

id name namespace
GO:0090307 mitotic spindle assembly biological_process
GO:0032147 activation of protein kinase activity biological_process
GO:0060236 regulation of mitotic spindle organization biological_process
GO:0072686 mitotic spindle cellular_component
GO:0005819 spindle cellular_component
GO:0005874 microtubule cellular_component
GO:0005880 nuclear microtubule cellular_component
GO:0008017 microtubule binding molecular_function
GO:0030295 protein kinase activator activity molecular_function

KEGG:

id description
ko03036 Chromosome and associated proteins

ZFIN:

id description
ZDB-GENE-030131-9652 Predicted to enable microtubule binding activity and protein kinase activator activity. Predicted to be involved in mitotic spindle assembly. Predicted to act upstream of or within activation of protein kinase activity and regulation of mitotic spindle organization. Predicted to be located in cytoplasm; microtubule cytoskeleton; and nucleus. Predicted to be active in mitotic spindle and nuclear microtubule. Is expressed in proliferative region. Orthologous to human TPX2 (TPX2 microtubule nucleation factor).

Ensembl:

ensembl_id ENSDART00000143523

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00044851 lncRNA upstream 151174 31863739 ~ 31885913 (+) True XLOC_021795
TCONS_00043214 lncRNA upstream 788142 31245431 ~ 31248945 (+) False XLOC_021787
TCONS_00043215 lncRNA upstream 788297 31245792 ~ 31248790 (+) True XLOC_021787
TCONS_00044850 lncRNA upstream 951136 31078564 ~ 31085951 (+) True XLOC_021785
TCONS_00043203 lncRNA upstream 1264201 30764287 ~ 30772886 (+) True XLOC_021777
TCONS_00043249 lncRNA downstream 156348 32194408 ~ 32201494 (+) True XLOC_021805
TCONS_00044852 lncRNA downstream 172198 32210258 ~ 32213360 (+) True XLOC_021806
TCONS_00044853 lncRNA downstream 212296 32250356 ~ 32253077 (+) True XLOC_021807
TCONS_00044854 lncRNA downstream 354433 32392493 ~ 32418824 (+) False XLOC_021809
TCONS_00043252 lncRNA downstream 354460 32392520 ~ 32397844 (+) False XLOC_021809
TCONS_00043235 mRNA upstream 3255 32028574 ~ 32033832 (+) False XLOC_021802
TCONS_00043234 mRNA upstream 9889 32021803 ~ 32027198 (+) True XLOC_021801
TCONS_00043233 mRNA upstream 16889 32011768 ~ 32020198 (+) True XLOC_021800
TCONS_00043231 mRNA upstream 29269 31979602 ~ 32007818 (+) False XLOC_021799
TCONS_00043243 mRNA downstream 1326 32039386 ~ 32060883 (+) False XLOC_021802
TCONS_00043244 mRNA downstream 6350 32044410 ~ 32060885 (+) True XLOC_021802
TCONS_00043245 mRNA downstream 28108 32066168 ~ 32085939 (+) True XLOC_021803
TCONS_00043246 mRNA downstream 63142 32101202 ~ 32107459 (+) False XLOC_021804
TCONS_00043248 mRNA downstream 63301 32101361 ~ 32107608 (+) True XLOC_021804
TCONS_00043229 other upstream 96213 31933675 ~ 31940874 (+) True XLOC_021797
TCONS_00043223 other upstream 369544 31667429 ~ 31667543 (+) True XLOC_021793
TCONS_00043220 other upstream 603424 31433579 ~ 31433663 (+) True XLOC_021791
TCONS_00043219 other upstream 603739 31433273 ~ 31433348 (+) True XLOC_021790
TCONS_00043209 other upstream 1057588 30979385 ~ 30979499 (+) True XLOC_021782
TCONS_00043247 other downstream 63151 32101211 ~ 32107481 (+) False XLOC_021804
TCONS_00043259 other downstream 369135 32407195 ~ 32409927 (+) True XLOC_021810
TCONS_00043260 other downstream 374474 32412534 ~ 32421750 (+) True XLOC_021809
TCONS_00043264 other downstream 1080950 33119010 ~ 33119124 (+) True XLOC_021816
TCONS_00043265 other downstream 1252213 33290273 ~ 33290361 (+) True XLOC_021817

Expression Profile

//