RNA id: TCONS_00009225


Basic Information

Item Value
RNA id TCONS_00009225
length 527
RNA type mRNA
GC content 0.43
exon number 4
gene id XLOC_004656
representative False

Chromosome Information

Item Value
chromosome id NC_007123.7
NCBI id CM002896.2
chromosome length 49182954
location 19188542 ~ 19191679 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TCCGGCGTTGCTAGGCTCCCCCCGGAATTAGCCGTTTGTTTACACATGTCTCTTATGGTTTCAGGAGCATCTAAGAAGCTGTCGTGAGGAAAATGCGTTTGTTTTATAAAAGCAGTTTCACTCCATCAATAAATTGAATACTATGTGTTAATAACGTGCATGTAAGTTACTAGTAAGTTAGCGCGAATCTCGAAGCTAACGGTAGTCTCACCTCCACGTTTGGTTAAGAAGTCAGACTATCTACTTCAAAATGCCCCTCTTTGGCAATATTTTCAGTCCCAAGAAAACCCCACCTCGAAAGTCTGCATCGCTTTCCAATCTACATACATTGGATCGGTCGACCCGTGAGATTGAATTGGGTCTGGAATATGGATCTCCTGTGATGAACATTGGTGGTCAGAGCCTCAAATTCGAAGACGGACAGTGGATTTCAGAATCGACAGCAGAAACACATCTAGTACAGAAGGAGCTTGAAGATATGAAGAGCAGTTCTAGGAGAAAGAAATAAAGGGAGGACACCTTTTATA

Function

GO: NA

KEGG:

id description
ko04310 Wnt signaling pathway
ko03036 Chromosome and associated proteins

ZFIN:

id description
ZDB-GENE-030131-5074 Orthologous to human CBY1 (chibby family member 1, beta catenin antagonist).

Ensembl:

ensembl_id ENSDART00000134726

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00009224 lncRNA upstream 47891 19139343 ~ 19140651 (+) True XLOC_004655
TCONS_00010915 lncRNA upstream 320567 18861278 ~ 18867975 (+) True XLOC_004648
TCONS_00009195 lncRNA upstream 643921 18543792 ~ 18544621 (+) False XLOC_004641
TCONS_00010914 lncRNA upstream 960538 18209871 ~ 18228004 (+) True XLOC_004635
TCONS_00010913 lncRNA upstream 1449086 17716325 ~ 17739456 (+) False XLOC_004630
TCONS_00010732 lncRNA downstream 77594 19267759 ~ 19271156 (+) True XLOC_004660
TCONS_00009244 lncRNA downstream 195273 19385438 ~ 19388378 (+) True XLOC_004666
TCONS_00010733 lncRNA downstream 268644 19458809 ~ 19459285 (+) True XLOC_004670
TCONS_00010916 lncRNA downstream 1073420 20263585 ~ 20265465 (+) True XLOC_004675
TCONS_00009263 lncRNA downstream 1153724 20343889 ~ 20346635 (+) False XLOC_004677
TCONS_00009223 mRNA upstream 44850 19138452 ~ 19143692 (+) False XLOC_004655
TCONS_00009222 mRNA upstream 44955 19138452 ~ 19143587 (+) False XLOC_004655
TCONS_00009220 mRNA upstream 123244 19036380 ~ 19065298 (+) False XLOC_004654
TCONS_00009221 mRNA upstream 129773 19036468 ~ 19058769 (+) True XLOC_004654
TCONS_00009219 mRNA upstream 152895 19030391 ~ 19035647 (+) True XLOC_004653
TCONS_00009228 mRNA downstream 1622 19191787 ~ 19198771 (+) False XLOC_004657
TCONS_00009229 mRNA downstream 3395 19193560 ~ 19198599 (+) True XLOC_004657
TCONS_00009230 mRNA downstream 9570 19199735 ~ 19204444 (+) True XLOC_004658
TCONS_00009231 mRNA downstream 14921 19205086 ~ 19232376 (+) False XLOC_004659
TCONS_00009232 mRNA downstream 18173 19208338 ~ 19232997 (+) True XLOC_004659
TCONS_00009203 other upstream 488920 18681423 ~ 18699622 (+) False XLOC_004646
TCONS_00009200 other upstream 589578 18598850 ~ 18598964 (+) True XLOC_004644
TCONS_00009179 other upstream 1062768 18125658 ~ 18125774 (+) True XLOC_004634
TCONS_00009175 other upstream 1247499 17927871 ~ 17941043 (+) False XLOC_004633
TCONS_00009172 other upstream 1460891 17727542 ~ 17727651 (+) True XLOC_004630
TCONS_00009243 other downstream 195261 19385426 ~ 19385555 (+) False XLOC_004666
TCONS_00009245 other downstream 197978 19388143 ~ 19388273 (+) True XLOC_004667
TCONS_00009249 other downstream 676833 19866998 ~ 19904415 (+) False XLOC_004671
TCONS_00009250 other downstream 687677 19877842 ~ 19896927 (+) True XLOC_004671
TCONS_00009270 other downstream 1308818 20498983 ~ 20499080 (+) True XLOC_004679

Expression Profile

//