RNA id: TCONS_00011334


Basic Information

Item Value
RNA id TCONS_00011334
length 572
RNA type mRNA
GC content 0.56
exon number 4
gene id XLOC_005714
representative True

Chromosome Information

Item Value
chromosome id NC_007124.7
NCBI id CM002897.2
chromosome length 52186027
location 2538636 ~ 2665113 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CGGTATCTCTCGCACTAGCTTTGAACGGCGTCTTCACAAATACTATCAAGTTGATAGTTGGCAGGCCAAGGCCAGACTATTATCAGCGCTGTTTCCCTGATGGCCAAATGAATGCCAAGATGCTGTGTACTGGAGAGCCAGACCTGGTGTCTGAGGGCCGCAAGAGTTTTCCTAGCAGTCATTCGTCCTTTGCGTTTTCTGGCCTGGGCTTCACCTCATTTTATTTGGCGGGCAAGCTGCAGTGCTTCACAGATGCCGGACGCGGACGCAGCTGGCGTCTCTGCGCAATGGTCCTTCCCCTCTACAGCGCCATGATGATCGCCCTGTCCCGCATCTGTGACTACAAACATCACTGGCAAGATGCTTTTGTCGGGGGAGTGATCGGCCTGTTCTTCGCCTACATCTGTTATCGGCAGCACTACCCGCCGTTCCTGCACATAGACTGCCACCTGTCCTACGCCAGTCTGGCTGCTGCCACCGTCCACAACATGCCAGCCTCCCAGGACCAGCCTCTGCCCACGGATAATGCCACCAGCCTGCCTCTGGAGGGCATGACGGAGGGTCCCGTATGA

Function

GO:

id name namespace
GO:0046839 phospholipid dephosphorylation biological_process
GO:0006644 phospholipid metabolic process biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0008195 phosphatidate phosphatase activity molecular_function
GO:0016791 phosphatase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-081107-53 Predicted to enable phosphatidate phosphatase activity. Predicted to be involved in phospholipid dephosphorylation. Predicted to act upstream of or within phospholipid metabolic process. Predicted to be located in membrane. Predicted to be integral component of membrane. Orthologous to human PLPP4 (phospholipid phosphatase 4).

Ensembl:

ensembl_id ENSDART00000164177

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00011324 lncRNA upstream 214245 2394622 ~ 2410905 (+) True XLOC_005711
TCONS_00011318 lncRNA upstream 272155 2352289 ~ 2352995 (+) True XLOC_005708
TCONS_00013539 lncRNA upstream 472134 2149770 ~ 2153016 (+) False XLOC_005706
TCONS_00013538 lncRNA upstream 472134 2149770 ~ 2153016 (+) True XLOC_005706
TCONS_00011315 lncRNA upstream 595693 2010287 ~ 2029457 (+) True XLOC_005705
TCONS_00013540 lncRNA downstream 6319 2671432 ~ 2676336 (+) True XLOC_005715
TCONS_00013541 lncRNA downstream 258807 2923920 ~ 2928455 (+) False XLOC_005722
TCONS_00013542 lncRNA downstream 259718 2924831 ~ 2928455 (+) True XLOC_005722
TCONS_00013376 lncRNA downstream 278168 2943281 ~ 2944990 (+) True XLOC_005723
TCONS_00011344 lncRNA downstream 594430 3259543 ~ 3260961 (+) True XLOC_005725
TCONS_00011331 mRNA upstream 99117 2523032 ~ 2526033 (+) True XLOC_005713
TCONS_00011328 mRNA upstream 126829 2442841 ~ 2498321 (+) False XLOC_005712
TCONS_00011335 mRNA downstream 67838 2732951 ~ 2828218 (+) False XLOC_005716
TCONS_00011336 mRNA downstream 67973 2733086 ~ 2826220 (+) True XLOC_005716
TCONS_00011337 mRNA downstream 165461 2830574 ~ 2849857 (+) True XLOC_005717
TCONS_00011339 mRNA downstream 196152 2861265 ~ 2871875 (+) False XLOC_005719
TCONS_00011340 mRNA downstream 196152 2861265 ~ 2892011 (+) True XLOC_005719
TCONS_00011320 other upstream 238617 2386413 ~ 2386533 (+) True XLOC_005710
TCONS_00011310 other upstream 859528 1765507 ~ 1765622 (+) True XLOC_005701
TCONS_00011289 other upstream 1775724 844143 ~ 849426 (+) False XLOC_005684
TCONS_00011277 other upstream 2114011 502319 ~ 511139 (+) True XLOC_005673
TCONS_00011274 other upstream 2186688 438347 ~ 438462 (+) True XLOC_005670
TCONS_00011338 other downstream 167979 2833092 ~ 2833207 (+) True XLOC_005718
TCONS_00011360 other downstream 1297654 3962767 ~ 3966255 (+) True XLOC_005731
TCONS_00011389 other downstream 3320663 5985776 ~ 6001981 (+) True XLOC_005757
TCONS_00011399 other downstream 3749171 6414284 ~ 6414400 (+) True XLOC_005764
TCONS_00011412 other downstream 4716405 7381518 ~ 7381633 (+) True XLOC_005774

Expression Profile

//

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
grasscarp (Ctenopharyngodon idella) CI01000005_04591681_04600244.mRNA True 1025 mRNA 0.49 5 CI01000005 4591681 ~ 4600291 (+)