RNA id: TCONS_00000471


Basic Information

Item Value
RNA id TCONS_00000471
length 536
RNA type mRNA
GC content 0.44
exon number 6
gene id XLOC_000282
representative True

Chromosome Information

Item Value
chromosome id NC_007112.7
NCBI id CM002885.2
chromosome length 59578282
location 23559478 ~ 23573230 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GTTGCTGAAATAATCTCTGATGTGAGGGAGCCTATTTTCCCCATCTCTGAGCCAGTGGATGAGAATGAGAAACGCAGAAAACAAGTCAGACTGGCTGAGGTGCGAGTACAGATAATGGAGGCCAAACAGACTCTAGAAGACTGCATCAGCTGTCAGGACTTTAGCCGTGCAGCTGAGCTAAAAGACTCCATCTCTCAACTGGAGGAGCTCAAGAACCAGCTTACCCTGGAGATTAACATTGAACCTGGACCTGCCAACAATGAACTGCAGCTCCTGTTAAAAGACATATTACAGGAAGTGAAAGATAAGTACTGCACAAGGGTTATTGAAAAGCTTTGCAACCAGCTAATCGGAGATCATGGTTCCAAATCAGCCAGTAACCAGGACACAGCTTTGCTTAACTTGGATGAAAACAATGGAGAGTTGATGAACAAAGATGAGACGAAACCTAAACGAGCAAAAAGAGGCCAGAAAAAAGCTGCCACTGCAAAGAATGGAAAAAAATCTTATAAAGCAGACATGTCTTCTGATGAAAG

Function

GO:

id name namespace
GO:0000070 mitotic sister chromatid segregation biological_process
GO:0007076 mitotic chromosome condensation biological_process
GO:0000793 condensed chromosome cellular_component
GO:0000796 condensin complex cellular_component
GO:0005737 cytoplasm cellular_component

KEGG: NA

ZFIN:

id description
ZDB-GENE-041111-282 Acts upstream of or within mitotic sister chromatid segregation. Located in condensed chromosome and cytoplasm. Is expressed in nervous system; optic cup; and pharyngeal arch 3-7 skeleton. Orthologous to human NCAPG (non-SMC condensin I complex subunit G).

Ensembl:

ensembl_id ENSDART00000142879

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00000466 lncRNA upstream 57173 23489111 ~ 23506518 (+) False XLOC_000281
TCONS_00000468 lncRNA upstream 57173 23505666 ~ 23506518 (+) True XLOC_000281
TCONS_00000462 lncRNA upstream 183481 23379008 ~ 23380210 (+) True XLOC_000278
TCONS_00003067 lncRNA upstream 1044937 22510734 ~ 22518754 (+) False XLOC_000269
TCONS_00002830 lncRNA downstream 545793 24118367 ~ 24119067 (+) True XLOC_000288
TCONS_00003069 lncRNA downstream 553806 24126380 ~ 24144170 (+) True XLOC_000289
TCONS_00003070 lncRNA downstream 764406 24336980 ~ 24337792 (+) False XLOC_000290
TCONS_00000481 lncRNA downstream 764488 24337062 ~ 24343734 (+) False XLOC_000290
TCONS_00000482 lncRNA downstream 765818 24338392 ~ 24343190 (+) True XLOC_000290
TCONS_00000464 mRNA upstream 145754 23406403 ~ 23417937 (+) False XLOC_000280
TCONS_00000465 mRNA upstream 145780 23408622 ~ 23417911 (+) True XLOC_000280
TCONS_00000463 mRNA upstream 164699 23398405 ~ 23398992 (+) True XLOC_000279
TCONS_00000460 mRNA upstream 167237 23372470 ~ 23396454 (+) False XLOC_000278
TCONS_00000461 mRNA upstream 169876 23372494 ~ 23393815 (+) False XLOC_000278
TCONS_00000473 mRNA downstream 210775 23783349 ~ 23910036 (+) False XLOC_000284
TCONS_00000477 mRNA downstream 212331 23784905 ~ 23912788 (+) False XLOC_000284
TCONS_00000476 mRNA downstream 212331 23784905 ~ 23912788 (+) False XLOC_000284
TCONS_00000475 mRNA downstream 212331 23784905 ~ 23912788 (+) False XLOC_000284
TCONS_00000474 mRNA downstream 212331 23784905 ~ 23912788 (+) True XLOC_000284
TCONS_00000467 other upstream 58588 23504334 ~ 23505103 (+) False XLOC_000281
TCONS_00000457 other upstream 283989 23274922 ~ 23279702 (+) True XLOC_000276
TCONS_00000444 other upstream 1042365 22521212 ~ 22521326 (+) True XLOC_000270
TCONS_00000435 other upstream 1997090 21564506 ~ 21566601 (+) True XLOC_000264
TCONS_00000430 other upstream 2309209 21254353 ~ 21254482 (+) True XLOC_000260
TCONS_00000472 other downstream 178525 23751099 ~ 23751213 (+) True XLOC_000283
TCONS_00000478 other downstream 294304 23866878 ~ 23866965 (+) True XLOC_000285
TCONS_00000480 other downstream 541951 24114525 ~ 24114558 (+) True XLOC_000287
TCONS_00000490 other downstream 810393 24382967 ~ 24384697 (+) True XLOC_000295
TCONS_00000495 other downstream 1547515 25120089 ~ 25120205 (+) True XLOC_000301

Expression Profile

//