RNA id: TCONS_00007433



Basic Information


Item Value
RNA id TCONS_00007433
length 725
lncRNA type retained_intron
GC content 0.48
exon number 2
gene id XLOC_003879
representative True

Chromosome Information


Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 6043742 ~ 6048490 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


CATCTGACTACCCACAAGTGTGACAGTGCTGCGGGGTATTTTGCTAACCTTTTGACCAGGTGCTTCATTTCACAACAAGCTCCAAGAATCAAAGTCCTCCGAAGGTTCATCTCTTTCCCACAACTGGACTGCAGATATGTACAAGAACAGCTACTCCCAGGCCACGTTCGGACTGGAGGCCAAAAAAATCCACAAGGCGAAAAAGGGGAAAAGCTGCGGCTACTACATGAGGATTGTGTTCTTCTTCTCGTCTCTGATCCAGTCGCTCATCATCGCCAGCTTGGTGCTCTTCCTCGTGTACGGACAGCCAGAGAAGACCGCCGAGGAGAAGAGGCTGGAAGACCTACAGCAGGCCTACGACACGCTCTCCAAAGACCACACCAAACTGCGAAAGGAGAAAGCCGATCTCGCTACAGCCCTCAAAACGAAGAGCGGAGAGAAGGACGCAGCAGACAAGGAGATCACGAAACTGAAAACTGACCTTAACATATCAATTGCCGGCAGCAAAAACTGGCAGAGGTTGAATAGTCAATGCGAGGCCAATGCTAAATTGAAGCTTTCAAGCACTCGAAATACTCCCCTCATGTGTCCACCAGCTAACCCCAATCAGAGTGGTGAGTCTATAAACCAATCAATGAATAATTAATGTCACGAATAAACCATCCTGTAGGCATCTCCCTCTTTTTTCGTCTCAGGTGAAGTAAAAACTCTGAATACTCTACTGG

Function


GO:

id name namespace
GO:0007219 Notch signaling pathway biological_process
GO:0043114 regulation of vascular permeability biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0003674 molecular_function molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-060616-96 Acts upstream of or within Notch signaling pathway and regulation of vascular permeability. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in caveola. Is expressed in vasculature. Human ortholog(s) of this gene implicated in congenital diarrhea. Orthologous to human PLVAP (plasmalemma vesicle associated protein).

Ensembl:

ensembl_id ENSDART00000147761

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00008449 lncRNA downstream 40332 6005807 ~ 6006741 (-) True XLOC_003878
TCONS_00008448 lncRNA downstream 82702 5957009 ~ 5964371 (-) True XLOC_003876
TCONS_00007426 lncRNA downstream 181498 5857278 ~ 5865575 (-) True XLOC_003873
TCONS_00008748 lncRNA downstream 272171 5773096 ~ 5774902 (-) True XLOC_003872
TCONS_00008447 lncRNA downstream 483652 5556890 ~ 5563421 (-) True XLOC_003871
TCONS_00008749 lncRNA upstream 37959 6086300 ~ 6096366 (-) True XLOC_003882
TCONS_00007440 lncRNA upstream 139041 6187382 ~ 6188413 (-) True XLOC_003883
TCONS_00007445 lncRNA upstream 156229 6204570 ~ 6206556 (-) True XLOC_003884
TCONS_00007448 lncRNA upstream 213352 6261693 ~ 6262709 (-) True XLOC_003885
TCONS_00008450 lncRNA upstream 228559 6276900 ~ 6278698 (-) True XLOC_003886
TCONS_00007431 mRNA downstream 45228 5965168 ~ 6001845 (-) True XLOC_003877
TCONS_00007429 mRNA downstream 93425 5945186 ~ 5953648 (-) False XLOC_003875
TCONS_00007430 mRNA downstream 93437 5946767 ~ 5953636 (-) True XLOC_003875
TCONS_00007427 mRNA downstream 107212 5933635 ~ 5939861 (-) False XLOC_003874
TCONS_00007434 mRNA upstream 2946 6051287 ~ 6068425 (-) False XLOC_003880
TCONS_00007435 mRNA upstream 3690 6052031 ~ 6069081 (-) False XLOC_003880
TCONS_00007436 mRNA upstream 12194 6060535 ~ 6068375 (-) False XLOC_003880
TCONS_00007437 mRNA upstream 15692 6064033 ~ 6070192 (-) True XLOC_003880
TCONS_00007439 mRNA upstream 134339 6182680 ~ 6188413 (-) False XLOC_003883
TCONS_00007400 other downstream 2093236 3953723 ~ 3953837 (-) True XLOC_003853
TCONS_00007330 other downstream 4958558 1069406 ~ 1088515 (-) False XLOC_003806
TCONS_00007326 other downstream 5067325 923795 ~ 979748 (-) True XLOC_003803
TCONS_00007304 other downstream 5587143 459815 ~ 459930 (-) True XLOC_003793
TCONS_00007296 other downstream 5695372 349113 ~ 351701 (-) True XLOC_003787
TCONS_00007438 other upstream 23619 6071960 ~ 6072066 (-) True XLOC_003881
TCONS_00007441 other upstream 148935 6197276 ~ 6206589 (-) False XLOC_003884
TCONS_00007456 other upstream 732367 6780708 ~ 6782076 (-) True XLOC_003894
TCONS_00007463 other upstream 895959 6944300 ~ 6948018 (-) False XLOC_003898
TCONS_00007477 other upstream 1067906 7116247 ~ 7116363 (-) True XLOC_003904

Expression Profile


//