RNA id: TCONS_00000419


Basic Information

Item Value
RNA id TCONS_00000419
length 479
RNA type mRNA
GC content 0.54
exon number 3
gene id XLOC_000252
representative False

Chromosome Information

Item Value
chromosome id NC_007112.7
NCBI id CM002885.2
chromosome length 59578282
location 19930520 ~ 19989584 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CCGGCTCTACCTCTGCTTTCCTCTCTCTTCTCATGTCATCCTCTCCTCTTGCGGCTGCTCAGTCATGATGCTGGGTAAAGACTACATGTTGGCCATTGTTATAGTGAATTACGAGGATATCTGGGGCGAGCAGTCATTTCAGACAGACCCTGATTTGCCTCCAGGATGGAAGATGATGACAGACATGGCTGGTATTTATTACTGGCACATTCCAACGGGCACCACACAGTGGGAGCGGCCAGCCCCATGCCATCCAGTGCCAACTGGACCCAGCCATGCCAGCCGCAAACACTCACTGGGTTCCCTGTCGCCTTCACCCACCCCAGATCATGAGTCGATGTCTCATGCCGATGTGTTTTTTGGAGCGTCGAGTCGTTCGGGCAGCACCACTTCTGACAGTTCGTCTGAGCCCGCTCCCATCCCGTCTTCTTCATGTCTGGACCCGACCCCCATCCTGTCCTCAAACTCATCCTCATCCT

Function

GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0005634 nucleus cellular_component
GO:0005737 cytoplasm cellular_component
GO:0008134 transcription factor binding molecular_function
GO:0001540 amyloid-beta binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-090313-73 Predicted to enable amyloid-beta binding activity. Predicted to be involved in regulation of transcription, DNA-templated. Predicted to be active in cytoplasm and nucleus. Human ortholog(s) of this gene implicated in Alzheimer's disease and cognitive disorder. Orthologous to human APBB2 (amyloid beta precursor protein binding family B member 2).

Ensembl:

ensembl_id ENSDART00000164661

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00000412 lncRNA upstream 122608 19808441 ~ 19821195 (+) False XLOC_000250
TCONS_00000398 lncRNA upstream 477583 19461925 ~ 19466220 (+) True XLOC_000242
TCONS_00000397 lncRNA upstream 481340 19458980 ~ 19462463 (+) False XLOC_000242
TCONS_00000395 lncRNA upstream 506126 19433007 ~ 19437677 (+) False XLOC_000242
TCONS_00003061 lncRNA upstream 678833 19253027 ~ 19264970 (+) True XLOC_000239
TCONS_00002828 lncRNA downstream 73137 20023932 ~ 20027926 (+) True XLOC_000253
TCONS_00002829 lncRNA downstream 76094 20026889 ~ 20029066 (+) True XLOC_000254
TCONS_00003062 lncRNA downstream 195610 20146405 ~ 20147549 (+) True XLOC_000256
TCONS_00003063 lncRNA downstream 985930 20936725 ~ 20938443 (+) True XLOC_000259
TCONS_00003064 lncRNA downstream 1380630 21331425 ~ 21341653 (+) False XLOC_000262
TCONS_00000415 mRNA upstream 57414 19849168 ~ 19886389 (+) False XLOC_000251
TCONS_00000416 mRNA upstream 57671 19855490 ~ 19886132 (+) True XLOC_000251
TCONS_00000411 mRNA upstream 141201 19764995 ~ 19802602 (+) True XLOC_000249
TCONS_00000410 mRNA upstream 187444 19708508 ~ 19756359 (+) True XLOC_000248
TCONS_00000409 mRNA upstream 187566 19708508 ~ 19756237 (+) False XLOC_000248
TCONS_00000421 mRNA downstream 118740 20069535 ~ 20138647 (+) False XLOC_000255
TCONS_00000422 mRNA downstream 133594 20084389 ~ 20141844 (+) True XLOC_000255
TCONS_00000423 mRNA downstream 642858 20593653 ~ 20607152 (+) True XLOC_000257
TCONS_00000424 mRNA downstream 684395 20635190 ~ 20695115 (+) False XLOC_000258
TCONS_00000425 mRNA downstream 684419 20635214 ~ 20705079 (+) False XLOC_000258
TCONS_00000414 other upstream 124707 19814865 ~ 19819096 (+) True XLOC_000250
TCONS_00000413 other upstream 128354 19808451 ~ 19815449 (+) False XLOC_000250
TCONS_00000408 other upstream 237971 19705699 ~ 19705832 (+) True XLOC_000247
TCONS_00000400 other upstream 404164 19535120 ~ 19539639 (+) False XLOC_000244
TCONS_00000377 other upstream 2081875 17858380 ~ 17861928 (+) True XLOC_000224
TCONS_00000420 other downstream 24796 19975591 ~ 19980987 (+) True XLOC_000252
TCONS_00000430 other downstream 1303558 21254353 ~ 21254482 (+) True XLOC_000260
TCONS_00000435 other downstream 1613711 21564506 ~ 21566601 (+) True XLOC_000264
TCONS_00000444 other downstream 2570417 22521212 ~ 22521326 (+) True XLOC_000270
TCONS_00000457 other downstream 3324127 23274922 ~ 23279702 (+) True XLOC_000276

Expression Profile

//

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
striped catfish (Pangasianodon hypophthalmus) TU467781 True 528 lncRNA 0.47 1 NC_047622.1 8941727 ~ 8942254 (-)
mexican tetra (Astyanax mexicanus) TU467781 False 1327 TUCP 0.52 7 NW_019172941.1 886412 ~ 897787 (+)